CShisMan2_615


Sequence

>CShisMan2_615 (4 EST) Length=413 CTCAATTATGTGGTCTGGAATTCTCGCTTTGTTAAAAACATTACTAATTTGTAGCAGCTCGACATTTATCTTCTATCATC ATACGTATTCTGAACTTTATTTATTCTCAGTTCTCGGTAAGTATTTACTGTCGCTGGTCATGTCAATTAGGTAGTGACTA CGAGTTTTTAGAAACTTTTGAGTAAATTGTAATTGATAATTAGGACTGTTCTCATACTTCTACTGACATATTAGTTTTAA ACGCACATTCCCTTTCCTGGTTTTAAATTATCTTAATCCTTCCTACTGTTGGTTGCGTAATGCAAACTGTGATTCTGCTC TATTTTGCATTTTACTGAATAATATCCGAGAGCCCTCATAGTTGCCTGCTGTATCTAGCAGATTTTGAATTAAACCGCTT AATATATTCCCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_615: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824431713281AA143876MCCE0262.M1RSchistosoma mansoni, cercariae
17533433228018AI014186MEEG0310.M1RSchistosoma mansoni, egg stage
17533773228052AI014220MEEG0392.M1RSchistosoma mansoni, egg stage
17533853228060AI014228MEEG0609.M1RSchistosoma mansoni, egg stage


Date: 0:22:32 on Fri 24 Nov 117.