CShisMan2_618


Sequence

>CShisMan2_618 (3 EST) Length=410 CCTTCAAAAGCATTTATTAAATTGCATGCTTTAAAGAGTAATAATATAGAAATAATAAATAGTATCATTGTTCTTTTCCC CCAAATAAACAAAAGTTCTATCAAATCTATATATATATATATGTATATGTATGTATACCACATTCCAAGATCTTTCTTTC AATGAATCAGATAGATACCCATTATGGTTTACTTCTTACTGAATATAACTACTATGTTACACTCACACACAAACAATCTT TCATAGATTAAGCTTTATGACCATTGTCATCCTGAAGGTAAGCAGAAATAATCTTGTGTTTATTCCACGATAAATAACCC AAATTACTTTTGGGTTGGTTTCAAAATTCAATGGTAAACACACAATCTGTAAATAAATAAATAGATAAATAAATAAAGAG TGTATTCCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_618: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192341128085N21952SMNHADA020072SKSmAW
5137641445017W06797SMEST0433Schistosoma mansoni, adult worm, Gloria Franco
7824281713266AA143861MCCE0240.M1FSchistosoma mansoni, cercariae


Date: 11:59:51 on Wed 22 Nov 117.