CShisMan2_623


Sequence

>CShisMan2_623 (2 EST) Length=443 CAGAATCTTCCGCGGGGATTTATAAAGTCAGCTATATCAATCTCATCTAANACTCCCANTTAANTGNCTAGCTAAGGGAT GATAAGAATATAAACCCNGGTAGACGTGGTTGAATACCGTTGCATTATATGTTGTTCCATAGATAGACGTAATGGTGCAT GTAAACCTTGAGTAGAAGCTAAAACTCTCATTCTATTCGCTTTTTCAGCTGCTTTACCAAATTTTGCAAGTGATTCAGCT ACTGGATGTGGNAAGCTAGTTGAATCTTCCACTTTAGACCCTGGGATTGCAGCCAATGATGATGCTTCTGCACTTGACCA TACAGTAGAACCAATTACATCGCCTAAACCAGTGTACATTAATGGTCGAACAGGGAATTNCAGGATGCAGCATTTGGTTT GCCTTCCTGACATAAAGCAAACTTTCGAAATCCCCTCGTGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_623: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191321127983N21850SMNHADA018077SKSmAW
12098372330126AA559430MC260401.NA3TBRI-Saber-cercaria-A


Date: 15:4:34 on Wed 22 Nov 117.