CShisMan2_628


Sequence

>CShisMan2_628 (9 EST) Length=642 CAATGATAAGCTTTGTACATTTTATATTAAGTAAGATCCAGTGAAAATTTTACAAAACTTATTAAATTATTAATTCAAGG TATATTTAGGCCATAAGAAATTTAAATAGAAGGGACGATAAATGAAACAATGAACTAAATTGACAAATATTATTTTTTTG ACTGATAGTAATTAAATAGTTCGAACTAGTGGTGATATTTTTTTTTACATTAGACATTAAGATACTACTAATTATAATAT GCTTTGGTTGTCAAAACAAAAAAACAAGATTAAAAAAGCAAGTAACTGACATGAGAAGAGACAAAATTTAGAAGCGTAAG ANGAAGAAGACCAACAAAACGTTCAACGTTGTCTGGCTTTACATATCTCAGTGAATTCCGGTTTTAATGAAGCTCCACCA ACCAAAAATCCATTGACATCATGTTGNTGAGCTAATTCTNNACAATTGGCAGCAGTNACAGATCCACCATAGATAATACG TATTTTTTCATCAACTCCATTTGGTGCATTCGTTTTAAACAATTTACGAAGGAAATTATGAACTTCTTGAGCTTGTTGTG GTGTAGCAACTTTACCTGTTCCAATAGCCCAAACTGGTTCATATGCTACGACTACTCGTTTCCATTCATCAGCTGATTTA AT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_628: (9 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5137141444967W06747SMEST0383Schistosoma mansoni, adult worm, Gloria Franco
5137481445001W06781SMEST0417Schistosoma mansoni, adult worm, Gloria Franco
7790841702743AA140583MEEG0120.M1FSchistosoma mansoni, egg stage
11587482252925AA514069MA2MA133.AA3S. mansoni adult Lambda Zap
12097982330087AA559391MC100404.NA3TBRI-Saber-cercaria-A
12098822330171AA559475MC260474.NA3TBRI-Saber-cercaria-A
17368723189792AA999237MCCE3019.M1FSchistosoma mansoni, cercariae
17369793189899AA999344MCCE3169.M1FSchistosoma mansoni, cercariae
17371933190113AA999558MCCE3483.M1FSchistosoma mansoni, cercariae


Date: 11:50:17 on Thu 23 Nov 117.