CShisMan2_629


Sequence

>CShisMan2_629 (2 EST) Length=412 GGCAAAATANTGACAAAGGTATCAATCCAAAGGGTTATATGCCAAGCCATTATTGAAAGAGTACAAATGTTACTATCGGA TAGATTTTTGGGTTTCTTTATGGTACCGCCTCAGACATCATGGAACTACAACTTTATGGGTGTGCTCCATGAACCCTAAA TATNGAAGTACTGAATTACAACCTTTCAAACCGAAGAAATTTTATCATCGTATTCATAGACCTTCACACTTNTTAAACTT TACATCTATCGAAGAGAATGAACTAACTTTAACTGACCGAGATAACCCCTTGGCATAAGTTGAATTTCATCACCGTATTT TGGGTCTACTTTATTTCCATTTTGTACATTAATCCTTGCGATTTCTCTTCCCCTCCTCACACTGCACTTGTACATACATT TATTCGAACGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_629: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8577981832558AA218465MAAD0124.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
17654253241832AI026218MEEG0455.M1FSchistosoma mansoni, egg stage


Date: 0:54:48 on Fri 24 Nov 117.