CShisMan2_63


Sequence

>CShisMan2_63 (9 EST) Length=640 CTGTTGGAGGTTCTGCATTTGGAAAAGGCTGATGAGAAACTGATTCNCAGGTTCCGGAAAATAATGTTTTATAGCGTTGT TGTTCTTTTGTATTTATTTTGTACGCAAATTTCTTGCTACATAGACGAATAATTTTGGGCACTGTCTTTGATACAAATGT TAACCGCGATACAAACATAGTTCGTCTAACTTCCGTTGATAGTTGACATAGGTGGAACTGAGTTCATCTAATTGACAGTA AATAAGGTACTTTTTAAGCAAACGGAAGTCTCTTGTCTTACAAACAAAAGGATGATAGTTTTATATAACAGTAATCTCGA TTGGCTAATTCATACAAAGAAACCAATTTGTTGTAAAGGCCAATTACAATCAACAAACTATAAACACAACCCCTAGTTCT ACTTAATTACAATCGGATAAATTAACTAAATAGGACAGTTGGAAGTAAGTAAAGATATTCTTGTCCCATAAAGCGACACG TAATCTTGAACAACGCCACTTTAATATGATGAGAGTTCGAATATCAAGGAATCTTGGGCAGCTTTTAAAGACCTTATTGT CGTTTCACAAAACCCAACTCGACTGTGTAGTAGTTAAGTCAGTGCAGGAAAACATGTAATCCCGGTAGCGTATCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_63: (9 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18148673385227AI067260EST208935Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148733385233AI067266EST208941Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149083385268AI067301EST208979Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152783385638AI067671EST209354Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153253385685AI067718EST209401Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155443385904AI067937EST209625Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156543386014AI068047EST209736Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158073386167AI068200EST209891Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159053386265AI068298EST209989Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 9:58:51 on Fri 24 Nov 117.