CShisMan2_632


Sequence

>CShisMan2_632 (42 EST) Length=1593 GGAGGTGTCTGATGACGAATCTGAAAAAGTAGAGTCAAAAGAGACTGAAGAATCTGATGACAAGCCGAAAGTCGAAGATC TAGATGAGGACGAGGAAGACGAGAATAAGGAGAAGAAGAAAAAAAAGAAGGTGACGGAGAAGTATACTGAGGAAGAACAG TTGAACAAGCTTAAGCCGCTCTGGACGCGCAATCCCGAAGATATAACTACACGAAGAGTATGCAGAGTTTTACAAGTCGT TAACTAATGATTGGGAGGACCACCTTGCGGTGAAGCACTTTTCTGTTGAAGGTCAGTTAGAGTTCCGTGCATTGCTTTTT GTGCCTAAACGCGCACCAATTGATATGTTTGAAGGGACGCGAAAAAAGCGGAGCAACATTAAATTGTATGTGCGAAGAGT CCTCATCATGGATACCTGTGAGGATATGATTCCCGAGTACTTGAGTTTCGTTCGCGGAGTTGTCGATAGTGAGGACCTGC CTCTTAACATCAGTCGTGAGGTGTTGCAACAGAACAACGTATTAAAGGTCATCCGTAAGAGCCTGGTCAGGAAATGTATT GAATTATTTGAAGAGATAGCAGAAGATAAAGAAAACTACAAGAAGTTCTATGAGCAATTCTCAAAAAGTATAAAATTGGG CATCCATGAAGATAGTGTGAATAGAGCGAAGTTGTCCGAATTATTACGTTTCTATTCTTCAGCTTCTGGTGATGAAATGA TTAGCCTGAAGGACTATGTGTCACGTATGAAACCTGAACAGCAGGATATTTACTACATAACAGGTGAATCAAAGCAAGCA GTGATGAACTCACCATTTGCTGAGAAACTTACTCAACGTGGATTCGAGGTGTTGTACATGGTCGATCCGATAGATGAGTA TGCAGTGACCCACCTACGGCAATATGAAAATAAAAAGTTAGTTTGCGTTACTAAGGATGGTCTTCAACTGCCTGAGAGTG AGGAAGAGAAAAAACAGTTCGAAGAGCTGAAGGCGTCGTACGAAACACTTTGCAAAGAGATTCAGCAGATACTTGGTAAG AACGTTGAGAAGGTTAGTATTTCGAATCGACTTACAAATTTCCCCATGTTGCGTTGTAACTTCAGAGTTCGGTTGGTCTG CTAACATGGAGAGGATCATGAAGGCACAAGCACTCCGAGACTCCAGCACTATGGGCTACATGGCAGCTAAGAAACAGTTA GAGCTGAATCCATATCATCCGATGATCAAAGCATTGAAAGAACAGTTTGAGAGTGGTAGTTCGACGAAACTTGTAAGGGA TCTCGTTCAACTATTGTTCGACACTGCATTGCTTTCTTCAGGTTTCTCACTGCCTGATCCCAAGCTGCACTCCAAGAGCA TCCACCATATGGTTTGCATGTGCCTGGATATTCCCGATGAAGAGATAAAGGCAAAGGAAGTCCCAAGTAATGGTCTCGAG AAAGAGGTCGCGCCTGCTGAAGTGGTTGATGACGGCATGGAAGAAGTGGATTAGCTTGTCTGCATTTTTGTATATATCCA GTGATTAATAAACGATAATCTTGAAAAAAAAAAAAAAAAAAAAAAAAAAACATGCCATGCAGCTGCATTACCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_632: (42 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39180514574T14407SMEST0068Schistosoma mansoni, adult worm, Gloria Franco
39189514583T14416SMEST0077Schistosoma mansoni, adult worm, Gloria Franco
39190514584T14417SMEST0078Schistosoma mansoni, adult worm, Gloria Franco
39229514623T14456SMEST0117Schistosoma mansoni, adult worm, Gloria Franco
39230514624T14457SMEST0118Schistosoma mansoni, adult worm, Gloria Franco
39254514648T14481SMEST0142Schistosoma mansoni, adult worm, Gloria Franco
345027981294R95634SMNHADA019063SKSmAW
5137321444985W06765SMEST0401Schistosoma mansoni, adult worm, Gloria Franco
7790781702737AA140577MEEG0109.M1FSchistosoma mansoni, egg stage
17579993233178AI018842SMEST0480Schistosoma mansoni, adult worm, Gloria Franco
17580033233182AI018846SMEST0484Schistosoma mansoni, adult worm, Gloria Franco
17580043233183AI018847SMEST0485Schistosoma mansoni, adult worm, Gloria Franco
17580133233192AI018856SMEST0494Schistosoma mansoni, adult worm, Gloria Franco
17580143233193AI018857SMEST0495Schistosoma mansoni, adult worm, Gloria Franco
17580293233208AI018872SMEST0511Schistosoma mansoni, adult worm, Gloria Franco
18145843384944AI066977EST208642Schistosoma mansoni, Phil LoVerde/Joe Merrick
18145883384948AI066981EST208646Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146073384967AI067000EST208666Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146183384978AI067011EST208678Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146213384981AI067014EST208682Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146333384993AI067026EST208695Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146493385009AI067042EST208711Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146683385028AI067061EST208731Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146953385055AI067088EST208758Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147063385066AI067099EST208769Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147093385069AI067102EST208772Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147963385156AI067189EST208863Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148023385162AI067195EST208869Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151273385487AI067520EST209202Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152353385595AI067628EST209311Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152383385598AI067631EST209314Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152903385650AI067683EST209366Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152923385652AI067685EST209368Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155273385887AI067920EST209608Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156393385999AI068032EST209721Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157013386061AI068094EST209783Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157033386063AI068096EST209786Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157213386081AI068114EST209804Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157543386114AI068147EST209838Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158143386174AI068207EST209898Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159263386286AI068319EST210010Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159453386305AI068338EST210029Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 22:0:34 on Sat 18 Nov 117.