CShisMan2_633


Sequence

>CShisMan2_633 (2 EST) Length=410 GCAAAAATTACTAGTGTATAACATACTGTACAGTAATATAAGTTTACAATTATTTAAACTACTCTGTTCTTTACTGAATA TACATACCTTAAAGGAAAAAAAAACAAAAAAAATAGTTGATCTCTTTCAAAAAAATATGTAACAGTATACAAGGGAATAA TTAGATAAGATAGAATAAATCTATTAGGAATCCCAAACGTTTATCTAAATAAAGTTGAATTGTATTGAAAATACTATAGT ACTATAGAGATAAAGAAAATCAAGTTCCGAATTGTGTACTTCATTTTAATCATCATTAAATGGATTTATTATTTAACATT ATTTATCTGATTTGGATATTGCAAATGTTTTCTTCGCTTCATCATTTACTGAACATATATGTGGTATATCCCGAAAAAAG TCATTGTAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_633: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18152303385590AI067623EST209306Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152623385622AI067655EST209338Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 17:53:47 on Fri 17 Nov 117.