CShisMan2_638


Sequence

>CShisMan2_638 (3 EST) Length=628 TCCAGATCCCTTAGAATGAATGATACCCAAGACTCTGCATCCCTCTTCAGCATCATCTCTTGCCACTCCCATCATGACAA AACCACTTACAAATTTGCAGACTCTCTTCTCCTCTTACCTGCTCACTACGTGATGGCAAAGGGTGAGAATTGATTCTCTT CACATCTCTCTGTCCTGCACTAAGTCTTCAGCATGGCCACATAGCTAAGCATCTCCTAGCTTTTCTTGTGCTTGGGAGGG GCCATGTGACTAAGTTCTGACCAATGACTGATGAGAATCACCCTGTATATTTTGGGGCTGTCTTTGAATAGACTTAGTTC TGCTCACTTTCCTCTCTCCTCTCTAAGATGTGGGTGTGGTGTGTAGGCATGGTGGTGCCTCCTTTTTTTTTTTTTTTTTT TTGAATCATAATTCTTGTCTATATATTTATTTCGTATCATATGTTAGTGAACAGATGAAGGAATTGTATTACAGACAAGT GATGAAACAGTCGTAACGCTGAAGACGGAAATGCATCTCAGTAAAAAGGGGTTAACACAAATGTTGTCAGTGTTTAGTAA CGCCCTGAAGGAAAACCGTCAGGTTAAAATGTCAAGCAGCTATCTTACGATCTATAGCTACGNGACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_638: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9103071907425AA269304MS1MM012.AS6S. mansoni sporocyst Lambda gt11
9103211907439AA269318MS1MM007.AS7S. mansoni sporocyst Lambda gt11
17609483237169AI021757ME0103.R1RSchistosoma mansoni, egg stage


Date: 21:23:28 on Sun 19 Nov 117.