CShisMan2_643


Sequence

>CShisMan2_643 (3 EST) Length=410 GCTCGGGNAAGCCNAACTTTCCCCTACGACCAGCAGAACCGCGGCACGTTCGATCCCTAAAAGCTCTGCGTCGCGCCGCA GTACTTCGCCTCGCAGNAAGAAACGCGACGCGGCGCGCCCGCAGATGCTGCTGCGTGCCAATGCGAATCAGGGCGAAGCG GTGTTCGAAACGGCCCGCCGCAGCGACGGCCCCGACGCGCAAGGCCGCTGGATTCGCGACGACTAATCCCGATGCGCACC TTCCTGTTCGATCTGCTGCGTCTGCCGGGCGAGGAAAACGAGTTCAAAGTCGTCGACCGCATCAGCAGCCGCGTGCACAA CCTGCCGCTGATGCCGTTGCTGTGCGGCGACAATCCGCTGACGAACAGTGCGCCGTCGAAATTCCTTTAAGTTTCAGCTT TGCAACCATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_643: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39165514559T14392SMEST0053Schistosoma mansoni, adult worm, Gloria Franco
39178514572T14405SMEST0066Schistosoma mansoni, adult worm, Gloria Franco
39226514620T14453SMEST0114Schistosoma mansoni, adult worm, Gloria Franco


Date: 18:41:4 on Sat 18 Nov 117.