CShisMan2_644


Sequence

>CShisMan2_644 (2 EST) Length=407 TCTGAATAATTAAGTAAAAAGATTACAAAATATTTAGTTTACAAACAAATTATGAAAATCATTAGTAAAAAAAAGATGAC GGTAATTATGTTGTCATTTGCAGTAATCACAATATAACTCGTATAACAGAGCTTAACATGACCATCCAAATCTCCTGACT AAGGAAATTATTGAGACACATCAAACTATCTTCAAATCCGCAATTTGTTCATACAATGTTGGGAAGTTCCACAATACGGG ATTNCCATCTCGACCGACTGAACTGAGTTCTGTCGCCATTGAACGATCACCTTTAAGAATTCGAATTTCATTAATGCAAT TCCGATGAATTGTGGGCAAACGAGAGCTAGTATTATCAGCTGTAGCCATGCGANCAATATCTTGACCTTTCTTCATAGCT GTTCACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_644: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39385514779T14612SMEST0273Schistosoma mansoni, adult worm, Gloria Franco
5136851444938W06717SMEST0354Schistosoma mansoni, adult worm, Gloria Franco


Date: 11:54:44 on Wed 22 Nov 117.