CShisMan2_648


Sequence

>CShisMan2_648 (3 EST) Length=407 AAGCAAAAAATCGATTTATTGAAAGTAATAAGCGGAACATTTAGTTGAATTTTCCTTTATGCATCTTCAAGTTCCTCTTC GAAATCACCTTCTTCCTCGGCGGTTGCATCCTGATATTGTTGATACTCGCTCACTAGATCGTTCATATTAGATTCTGCTT CGGTAAACTCCATCTCATCCATACCTTCGCCAGTGTACCAATGCAAGAAAGCCTTTCGGCGGAACATAGCCGTGAACTGT TCAGAAACACGTTTGAAGAGCTCTTGGATGGCAGTACTGTTGCCAATGAATGTCACGGACATTTTCAGTCCACGGGGTGG AATATCGCAGACGGCAGTCTTGACGTTATTCGGAATCCAATCCACGAAGTAACTGGAATTTTTTATTTTTGAACATTCAA CATTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_648: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39365514759T14592SMEST0253Schistosoma mansoni, adult worm, Gloria Franco
5137151444968W06748SMEST0384Schistosoma mansoni, adult worm, Gloria Franco
7791181702777AA140634MEEG0202.M1FSchistosoma mansoni, egg stage


Date: 11:13:10 on Sun 19 Nov 117.