CShisMan2_649


Sequence

>CShisMan2_649 (3 EST) Length=408 CGTACATGACTTTGTTGCAGCGCATCGAATTGGAGCGAGGAAAACGGGAACCTGGAGAAATCACGGAACTGAATTTGGAC AACTCGAAATCCGTGGATATCGAAGGTCTCACGGATGAATATTCGTCCTTAGAGGTCTTGAGTATGATGAATGTTGGTCT TCAAAGTTTGGCTGGTTTACCTTGTCTTGCCGGCCTAAAAACTCTTGAATTGTCGAACAATTTGATATCTGGTGGTCTTG ACGCTCTGCTCAAATGTCCCAACATTGAGCAACTTAATCTAAGTAGCAATAAGATTGAATCAATGGNATGTATTGATTCC ACTGGCTAAGCTATCCGAACTCAAAAGTTTGGACCTCGGGAACTGTNCCTGTCACCTCTANGGAGAATTAACCGGAAAAA GGCTTTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_649: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8577921832552AA218459MAADO117.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
8577931832553AA218460MAAD0118.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
8577941832554AA218461MAAD0119.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)


Date: 8:53:0 on Tue 21 Nov 117.