CShisMan2_65


Sequence

>CShisMan2_65 (3 EST) Length=638 GTGGCGGCCAAGCGTTCATAGCGACGTCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCA CCAAGCGTTGGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTA CTAATGAGTACATCAGTGAAGTACAATCTGGCCGTTGCTATGGTAATCCTGTTTAGTACGAGAGGAACCGCAGGTTCAGA TAATTGGTATATGTGCCTGGTCGAAAGGCCAATGGTGCGAAGCTACCATCTGAGGGATTAAGACTGAACGCCTCTAAGTC TGAATCCCGTCCAAATTTGCAACGGTACATTCTGTATCCGACACGTGGCTGGGCAAGCTTACGTATTCCTTTTGGTGTCT GGACTGGACCATGTGTTCGGCTAGGCCCATTAGGTCTGGTGTTATGCCAGAGCGATGACCATAAACCGTGCTCCGGATTT TGGGGTACGGGGGTCGACACGATATCTAATTGTGGTATGAGCGTGAGGATACTAAATCGTTTGTAGACGACTTAATGTTT TGTCGGGGAGACGTAAGTGCTCGAGCAGCTTTCACACTGCGAGGCATTGAATCCTATCCCTGCTTGACGTAATCATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_65: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180201125909N20737SMNHADA007057SKSmAW
18155053385865AI067898EST209585Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156923386052AI068085EST209774Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 18:43:7 on Sat 18 Nov 117.