CShisMan2_651


Sequence

>CShisMan2_651 (3 EST) Length=407 TGGTCGAGTTGTATGCACAGATGATGAACAAACTACAGTCAGTAATGTTTATGCCATTGGAGATATCAATGCTGGAAAAC CACAATTAACTCCCGTGGCTATTCAAGCTGGGCGCTATTTGGCTAGACGTCTGTTTGCTGGTGCAACTGAACTAACTGAC TATTCCAATGTTGCTACAACGGTTTTCACTCCACTTGAATATGGGGCTTGTGGATTAAGTGAAGAAGATGCAATTGAAAA GTATGGTGATAAAGATATTGAAGTATATCATTCAAACTTTAAACCTTTAGAATGGACCGTCGCTCATCGTGAAGATAACG TTTGTTACATGAAACTCGTTTGTCGTAAATCTGACAACATGCGTGTACTGGGTCTGCATGTTTTGGGTCCTAATGCTGGG GAAATAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_651: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18153003385660AI067693EST209376Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153013385661AI067694EST209377Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158823386242AI068275EST209966Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 0:32:51 on Fri 24 Nov 117.