CShisMan2_656


Sequence

>CShisMan2_656 (3 EST) Length=406 AATCTCAGAATAAATTCATTTCAACATTATTACATCTACATCTATATATAGAGCAATAAACTCATGTGTTGAGAGAGAAA AAGAAGTTACAAAAGCGAACTGTTTTCAAAACCATAAGCAATAGATACGTTGAATATCTGAAAGGTATAACATGCAAAAA TAAACACATAGAACGATGTAAATTCTTGTTTCATTGATACCGGATAAGGATCAACAATGATTAGTGTCAAAATATTGTTT TTTATATGTTGAGAGAGAGAAAGTGTGTGTGTGTGTGTGTGTGATCACAGATCTAATCAGCCTTCTTGTTTGTTGAACCA CCACTTTCTAACATCTGAAGACGATATTGTAGTTTTTGGCATTCTTGTGTGACACGATCGTATTCAGTATTAGTTTGAAG AGTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_656: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18148933385253AI067286EST208963Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149513385311AI067344EST209022Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159423386302AI068335EST210026Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 6:52:48 on Mon 20 Nov 117.