CShisMan2_66


Sequence

>CShisMan2_66 (5 EST) Length=638 CTGCAAATGAAGATGATGATGAAGATATTTATGACCCTAAAAGCAAAGGATTCTGTCGTGCATGTGTCGACTTGTCAAAG TTCGGTCTTTTGAAAGCAAAGGAGATGGTTTCCAAACCGAGTATAGAGTGTCCACCGGATAAAATTGAACTTGGAAAAGC GACATGGACTTTTTTGCATACAATGGCAGCATATTACCCTATACATCCGACATCGAAACAACAAGAAGATATGAAGAAGT TTTTACAAACATTTGCACAGTTCTTCCCATGTCGACAATGTGCTTATGATTTTGAATCTAATATTATTGTTCATCCACCA AAATTGGATAGTCGTAATGCATTAAGTGGATGGTTATGTATGCAACATAATTTAGTGAATAAAAAAATTGGTAAACCATT ATTTGATTGTACTTATGTATTAGAAAGATGGCGATATGGTTGGAAAGATAAAGATGATTGTAAACTACCAGAACAAGATT AGTATTGTCTTTTAATGAATATGTATAATGTGTGTGTGTGTGTGTTTAGTGATTATTCAGTTTCTTTCCGTTCTATCTGT TTTCTTATGTTGTCGGTAGTACTTTTGTATACTAAAAGACTATGAGTAGTATATAGTGACCAATCATCATTATAGAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_66: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4192411128092N21959SMNHADA020081SKSmAW
4192481128099N21966SMNHADA020082SKSmAW
8247891769640AA185826MAAD0106.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8247901769641AA185827MAAD0108.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8247911769642AA185828MAAD0109.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)


Date: 11:52:9 on Wed 22 Nov 117.