CShisMan2_660


Sequence

>CShisMan2_660 (2 EST) Length=490 GGGAATCAAATGGAATATCCCACCCTATAATTTACGTGTCGTACGTAAATATAAGCGCCGTAAAATTACTTCATAGCTAC TCCGTTAAAATATGTTTAATTGTAAATGAGGATCTATATATTTATTGTCGAATATGACTTCTTTTTTTTAAAAAAGGTTT TATATTTTTTATTTCTTCAATGTTGTTACTTTGTTTACTANATTACTTGTTTCACTTCTGTTATACCCATGTGCGCGCTT ATTTTGAATATATATATATATAGAAAATCAGCATTTAACTTGGTCTGGTTCACTATTATATTTTTTCTGTTGTATTTTAC TTTGTATTAATTAACCTTATATTGGTTATTACGACGTGTTATTGAAATTTACATATTGCTTTATATGCTTAATATTATCC CTAGACAAAAGCTAATAATCTAGTCTACAAGGGAAATCAGCAAATCATTTTTCAACTTGATCCTGATTAAACTAAGTGAC TAATAATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_660: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5679171366665W59927EST000445S. mansoni cDNA
18696383510039AI111069MF001D06.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 12:4:47 on Wed 22 Nov 117.