CShisMan2_67


Sequence

>CShisMan2_67 (5 EST) Length=633 GCACGAGATTATTAGCAGCCTAAATAAGTGGGTTGGTATCTTGAGGGAACATGTTGGTAATCTCAAAGTTCCAGATGAAA AGCTTCAAGAATACAAGAAAAATATTTTGCGCCAGTTCTGTAGTTATCTAGAACCTGATGTACTGGCGAACACTGCTCAT GTTGCACCCATATGTATCAGCCCATCTGGTAATCATCAACCTAATGGACAACCTGTTTCACCGAAAAAGTTATCGGGAAT ACACCCTGCAACAGCTGCCCTTCTTTCAAGTACATTAAACTCACTATCTGAAACTGCGTCTCAGCCACCATCTGTTGTAA ATGTTGGACAAGCAAACATTTCTATGGAAACAAACACTGATGAGAATGCTCTAACCAACAATTTGGGGATTCCAATAGTT GTAGTGATGACAAAGGTTGATTCTATGGGGGCTCTGGAAAAAGAAAATCAGTTCACAGAAGAACACTTTGACTTCATCCA AATGCACGTTCGACGTTTCTGTTTGTCCTATGGAGCGGCACTGTTTTATGTGTCAGTAAAGGACGACAAAAACTGTGATT TACTGAATCGTTACCGACAAAGTCGTATCTACGGGTTTCCATTCAGTCAAACTGCGTATGTTGTCGAAAGAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_67: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18147913385151AI067184EST208857Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150783385438AI067471EST209153Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155713385931AI067964EST209653Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157173386077AI068110EST209800Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158663386226AI068259EST209950Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 0:51:23 on Fri 24 Nov 117.