CShisMan2_671


Sequence

>CShisMan2_671 (3 EST) Length=404 CACTCGAAAATAATGTAAATAAACAACTTTAAAAGTGGCAGTAACAATAATATTAACAATTAAACAGAAAAATCGTTCAC TCTTTTTTGTTAGTCGAGCAAACACAAAGAATTTCATTTTGTACAAGAAAATGACTCATTATGTAGATAAGAATGTGTAA GTCTCTGTGTATGTGCGTACTTACAGAAGACTTTCAGTTGAGAAATTCACCAGGTGGAGAATGTGAATATGAATCAAGGT ATACAGAATAGTTACCCTTGTAACCGTGCTAAGTCAATCCCAATACAAATAGGAAAAGGCCATAAGCAAGAGAGGAATGA CGTCATTTTTTATCTACGTACACGTACACACAGTTATGCTAAAAAAAATATGGAATATACTCGTTTATATGTATATATTA TTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_671: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18152693385629AI067662EST209345Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152803385640AI067673EST209356Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157293386089AI068122EST209812Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 8:44:34 on Fri 24 Nov 117.