CShisMan2_673


Sequence

>CShisMan2_673 (2 EST) Length=404 GATGACGACAAAGTAACCTGAAGTAGTTTATACAAAATATTATCATTCCTGGTATCTCCACTAGAAGAAGTGAATTACCG TCGCCAAAAAAACTTCGTACACGTTAAGACACTTGTTGACAGTGACTTGTAGGAAAGCCTGATTTATATAAATATAAATA TATACATATGTATACGCATGTCATCTTGTCATTTTCACACGTTTCCTTGATTAACTTTACCCCTCCACACATATACGTTT CCTCGCTTTACCATCTCACGAGGTAATTGTTCACGTTCATTCTTTTCGTCTTATTATTATTACGATTTATTCTTTTAAAC ATCTTTAGTTATTTTACTCATCAGATGTTTGTGGTGAGAATGGTTTTCCTTTGTTTTCCCCTTGAATTTTACTTTCTCTT GCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_673: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18694943509895AI110925MF003A08.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695393509940AI110970MF002E10.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 23:19:8 on Mon 20 Nov 117.