CShisMan2_676


Sequence

>CShisMan2_676 (2 EST) Length=647 GGATCCCAGCCATATACCTTGAACCCCAACANTATGGCTCAATCCAATTCAAGGAACATTATAGATTGGATGCCCTACCT TGATTTGGTCACTCCTAGCTTTTATTTCAACCTATTCCTGTAAATAANACTGTAAACTGTCAATAATAAATGCCATATGA CTACGAACTAGGAGGCGTTGATNTATACAAGACTGCAATTGAATAAAAACATTGATTGGTGNTTTATTATAATTTACATG GAGCTGATTACGAGCAGAGGTACGACGCCACAAAAGAATTTGATCAGCCCAAAACTCGTTGTAATTTCCAATTGTGTTCG ACGGATAGCGAATAGAAATCCTAAATAACCTGTCGTAAGCACGACAAATATTAGGAGAGAATAAACGTTCGAAACACCGG TGGAGNCAATAATGGCATNNATGTAGNCGATCCNAAACAGTAATATTTTCTGACGACTTATNTGATTGAGCTGCTGCCAA CTTTATTGAGAATATGAGGCAGACACATGCACCACATTGATTGCNAGAACCAAAGCGGATGTTGTAANCTAACAGCCAAC CCTGTTAATGTTTACAGCAACTTTTGGAAANCCCNAAATAATATTTGGACTACGGACTGACGGATTATGATAATCGAACT AGTTGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_676: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4350311154055N33656SMNHADA009002SKSmAW
18695733509974AI111004MF002B11.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 5:13:57 on Tue 21 Nov 117.