CShisMan2_677


Sequence

>CShisMan2_677 (2 EST) Length=403 AAGAATCATGGAATATATATTTATATATATATGACGAATATATAGGTTTATACTTTAACAGCTGTATTTTGATAGTAGAA TAAATTGAACTCAAAGCAGAAAAAACAAGACAATAATAAAAAGAACAACGATGACAATAAGCCAGTGTTACAATGACAAA ATATAAGTCAAATTGTAGGCATATATATATATATATATATATGACGACATATAGAGTACATCACACATATGAAGACACGT GCAGTGCCAAACAAAGGGGGGGGGGGGCAGGAGAAATAAACAAATACTTGTACACAGCAGCTTGGCTGTATGACTAAATG AAATAATCCGAAAAGAAAACGATACGTGTAACTATGAAATAGATCTAATCAGTTAACTGTTTCTATTTTTGCAATAGTCA AGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_677: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17369003189820AA999265MCCE3065.M1FSchistosoma mansoni, cercariae
17653773241784AI026170MEEG0406.M1FSchistosoma mansoni, egg stage


Date: 18:29:53 on Sat 18 Nov 117.