CShisMan2_682


Sequence

>CShisMan2_682 (2 EST) Length=406 CTCCAACCCACTCGTATCCTGGGACTCCCTTTCTAGTTCTATCCAATTTTTAGTTCATCCTTCTCATGTCTGTCTCCATT TCTCGGCGTAATGTGTTCTTTAGGTCTTCCTCTTCTCCTTTGACCTTCAAGATTCCATGTGAGGGCTTGCCTTGTGACGC AGTTGGGTGATTTCCACAAATGTGCGCCCAATCCACTTCCAGTGCTGCTTCCTGATTTCTTCCTCAGCTGAAATCTGGTT TGTTCTCTCCCACAATAGAATGTTGCTGATAATGTCTGGCCAACGGATCCGAAGTATTTTGCGTANACAACTGTTAATAA AGGAGGGGGGAATTGGATCAAATTACTTCATATTCATTTTATAAAGTGGGTAAATCTTTTGATTTATAACATCAAAATAA CAAAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CShisMan2_682: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11529382245773AA508333MAAD0404.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
18694923509893AI110923MF003A10.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 23:19:43 on Sun 19 Nov 117.