CShisMan2_683


Sequence

>CShisMan2_683 (3 EST) Length=478 GGGTNGGGCTTNACCCTCACTAANGGGNACANNAGCTGGAGCTCCANCGCGGTGNCGNCCGCTCTAGAACTAGTGCATCC CCCGGACTGNAGGAATTCGGCACGACNACAGCTTGAAGATGAATTGGAATCTACTGAGACTCGTCTTCAAGAAGCTACTG TTAAGCTTGAAGAAGCAAGTAAAGCTGCTGATGAAAGTGATCGNGGTCGTAAAGTATTGGAGANTCGTACTTTCGCAGAT GAAGAACGTATCAATCAGTTAGAAGAACAATTAAAAGAATCTACATTTATGGGCTGAAGATGCTGATCGAAAATACGATG AGGCGGNTCGTAAGCTGGNTATCACGGAAGTGGAACTCGAACGGGCTGAGTCTCGCCTGGAAGCTGCCGAAAGTAAAATT ACAGAACTCGAAGAAGAGTNACGCATTGTTGGGTAATAATGTAAAATCTTTGGGAGGATATCTGAACAAGAGGCAGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_683: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4291931145919N28063EST000017S. mansoni cDNA
7808151705410R95617SMNHADA017091T3SmAW
12165602338809AA566177MA3MARO6.AA3S. mansoni adult Lambda Zap


Date: 21:23:27 on Fri 24 Nov 117.