CShisMan2_684


Sequence

>CShisMan2_684 (4 EST) Length=401 TATTTTTGAGTAATAACAGTTCATTAGATTATGATTCATATAGATTGGTATAGTATTTTACAAATTAAGTAGCTTAAATT TAATATCTATAATGTTCCGCCTTGAATGGTCCTTCAACTGGTACACCCAGATAATCAGCTTGTTTTTTGGTTAATTTCGT TAGTTTGACACCTAACTGTTCCAAGTGAGCGGCAGCAACAGCCTCATCCAGCTTTTTAGGGAGGAAATGGACGCCAACTG GATACTGATCGGGTTTTGTCCATAGCTCAATTTGTGCTAGTACCTGATTTGTGAAAGAGTTTGACATTACGAAACTAGGA TGGCCATGAGCACAGCCTAGATTTACTAGGCGACCTTCTGCAAGTAGAATAATATGTCTTCCATTTTTTAATGTGTAACG A


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_684: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18152193385579AI067612EST209294Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154143385774AI067807EST209491Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154623385822AI067855EST209539Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156883386048AI068081EST209770Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 15:31:19 on Fri 24 Nov 117.