CShisMan2_685


Sequence

>CShisMan2_685 (3 EST) Length=417 AAATGAGCTTAAGCTCAAAAAAGTTCCAAGTTTCATGCATTCATAGTGATATGGATCAAGAAAAACGTGATGCAGTTATG GAGGAATTCCGTAGTGGAAGATCCCGAATTTTGCTGTCCACTGATATTCTGGCGCGTGGTATCGATGCCCCCCGGTCTCA TTAGTCGTTAACTATGACCTACCTAGTAATCGTGAGACATATATTCACAGAATCGGGAGAGGAGGTCGTTCCGGTAGAAA AGGTACAGCCATCAACTTCATCACTGAATCAGAAGTAGAAGCTCTAAGTGACTTACAGCAATATTTCAATACAGAAATTC TTGAGATGCCTGATGACATTGTTGATTTTCTGTACCTGAACTTGAGCCCACTTATACATTTTAATATTTGTTCCTAGCTG AGCTACTTTCAGTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_685: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3644431017370H63024EST000272S. mansoni cDNA
16716353098722AA938823SMTBADA000272SKSchistosoma Lambda Zap II
17653993241806AI026192MEEG0428.M1FSchistosoma mansoni, egg stage


Date: 14:14:38 on Sat 18 Nov 117.