CShisMan2_686


Sequence

>CShisMan2_686 (2 EST) Length=401 GAATGTAAAAAAGACTCTTTATTATTAAAATTAGAAAAAAGTAAATGTGAGTTTCCTAGCAAAGATAAATGTTGTGTAAA AAACTCTAGATTTTACATCATCCGTTCTAAAATGCATGAAATTATGAATAGAAAGACAATGTAAACTAAGGTGATAAGTA GAATTGTTGAATATGTTTTTAAAACAATGTTTTAAGAACAGTTTAGTAATAGAGATTTCTCAACTCTTCCACTTTCATGT ACGTTTAGAATGCTTTGAATGTTGTTTATATCTGTTAGAACTACGGCGTAAATTATTTACTATATTTGCAGATATTTCTT TTGTATCTGTCAGGTCAGGTATTCGTATATTGGATTCTGTTAATCTAGGACAATAGATGATAGTCTTTTCGGGATTAGGA T


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_686: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18153683385728AI067761EST209445Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157263386086AI068119EST209809Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 23:26:8 on Fri 17 Nov 117.