CShisMan2_69


Sequence

>CShisMan2_69 (2 EST) Length=632 TGGTTCTNTTACCAATTGGATGGAAGTGAACATGCTGAACGAGCATTTCAGTGGGTATTGGACTAATATGAAGAGTTCAA ATGATATTGTGAAATTGGTTAATATTGTGGAACCAGTTTATGCTACACCTGCAGTTGGATTAACAACGGAAACTCCACCA TTAACTGATATTACTAAAATAATGCAAGATAGCATGGATAAAGGCAAGTTATTGGGTAAAAAATATATAGCTGAAGCAAA AAAATATGATATAAACTGTCAAGCATCTCTTCATGTAGACAATCGACCTGGTGCAGCTTTATTAAAATCAATAGAAGATC ATAATGCAAATTGGATTATTATGGGAAGTAGAGGTCTTGGTATTACTTCGACGTACTTTTCTTGGAAGTGTNTCTGATTA TGTATTACATCATGCTCATATACCAGNGGTAATGGTCCCACCAANGTAAAAAAAAAGTAACAATGGANCATNTTTACTCT TTAANTTAAAAATNTGTNCCANTTAAGTTNTTTTTGGGCATAATATTCAACATTTNTTNNTCATAAACACGATTCATGGT AAAAAGGCAGGGTATNTTTCANCCCATGTANCTGNTCCTTCGAGGATTTTTATAAAGGTGGTTTGANTTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_69: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180331125922N20750SMNHADA007095SKSmAW
4192211128072N21939SMNHADA020049SKSmAW


Date: 3:49:18 on Sat 18 Nov 117.