CShisMan2_691


Sequence

>CShisMan2_691 (2 EST) Length=417 TGGCATACATAACACTGTCATTCTCTTATTACTACACATATTGAACAAGAGATAGAAATTGTACGTGTGTTGAAAATATA AGAATAGGAGAAGCAGTTCGAATCATTATTATCTCAATCAATAATATTGATGGAAAGGTCTATGTACACATTAAACAAAC ACCACTTCTATATAAATTTATCTTCACAGAAGCACACAAAGTGTATAATTAACAAAATATACAGTGTTATAATGAACTGA TTGGAAGTGATTAAAAAAATCTAGTATGAAGGAAGAGAATNGAAGAAGACGAAAAGGAAATGTGGAAGAGGGAAAAAGAG GAATAAAACAACTGACCCAGGATATTATTATATTCTGAGGTCAGCAAAATGTTTCTCAGCTAACTGTAAGATATCTTCTC GTTGAACTGGAGACTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_691: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165512338800AA566168MA3MA136.AA3S. mansoni adult Lambda Zap
13277522552089AA629478MU000024.Y2RSmL


Date: 2:35:33 on Wed 22 Nov 117.