CShisMan2_692


Sequence

>CShisMan2_692 (10 EST) Length=537 CTGGTAAAACGATCACTTTGGAAGTTGAGCCGAGTGACACCATTGAGAATGTGAAGGCCAAGATCCAAGATAAAGAAGGG ATTCCACCTGATCAACAACGTCTGATCTTTGCTGGTAAGCAGCTAGAAGATGGTCGCACATTGTCTGATTACAATATCCA GAAAGAGTCCACTCTTCACTTGGTGTTGCGTCTTCGTGGTGGTATGCAGATTTTTGTGAAGACATTGACTGGTAAAACGA TCACTTTGGAAGTTGAGCCGAGTGACACCATTGAGAATGTGAAGGCCAAGATCCAAGATAAAGAAGGGATTCCACCTGAT CAACAACGTCTGATCTTTGCTGGTAAGCAGCTAGAAGATGGTCGCACATTGTCTGATTACAATATTCAGAAAGAGTCCAC TCTACACTTGGTGTTGCGTCTTCGTGGAGGTTAACTTTAATTTTGTTCATTTAACTTAATAAACGTTTAATTTAACTTAT TAAAAAAAAAAAAAAAAAAAAAAAAACATGCCATGCAGCTGCATTACCGTACTGCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_692: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39117514511T14344SMEST0005Schistosoma mansoni, adult worm, Gloria Franco
39118514512T14345SMEST0006Schistosoma mansoni, adult worm, Gloria Franco
343542973946R95216SMNHADA001042SKSmAW
344949976005R95520SMNHADA018035SKSmAW
5137371444990W06770SMEST0406Schistosoma mansoni, adult worm, Gloria Franco
14785892804085AA756915MF4MA157.AF3S. mansoni female adult Lambda Zap
15130302854310AA791355SMTBADA000847SKSchistosoma Lambda Zap II
15130412854321AA791366SMTBADA000917SKSchistosoma Lambda Zap II
17372703190190AA999635MCCE3648.M1FSchistosoma mansoni, cercariae
17581653233344AI019008SMEST0648Schistosoma mansoni, adult worm, Gloria Franco


Date: 0:42:2 on Fri 24 Nov 117.