CShisMan2_70


Sequence

>CShisMan2_70 (4 EST) Length=631 GGGAACAAGAACATCATACTGGTCATTTTGCATGTCATAGTTGTGATGTATCATTAACAGGACAACGTTATATATTACGT GATGATGAACCACATTGTTTAGCTTGTTATGAAGCAAAGTTTGCTAATACATGTGAACAATGTAAAGAAAAAATTGGTTG TGATTCAAAAGATCTTTCATTTAAAGAAAGACATTGGCATGAGAAATGTTTTAAATGTTCTGCTTGTACTACTTCATTAG CTGATCGACCATTTGCTACAAAAGAAGAACAATTATATTGTTCTGATTGTTATGATGAACGTTTTGCTGCAAGATGTGAT GGTTGTCAAGGTGTATTCAAAGCTGGAATGCGTAAATATGAATATCGTGGACAACAATGGCATGAAGAATGTTTTTTATG TGTTGAATGTAAACAACCAATTGGTGCAAAAAGTTTTATTCCACGTGAAAATCAAGTTGTATGTGTACCATGTTATGAAG CGAAATATGCTCAACGTTGTACGAAATGTTCAGAAGTTATACGTCGTGGTGGAGTTACATACAAAGGAAATCCATGGCAT AAAGAATGTTTCACTTGTACTAGTTGTTCTAAACAATTAGCCGGTTTAAAATTCACATCTAAAGATGAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_70: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18147273385087AI067120EST208790Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147923385152AI067185EST208858Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157783386138AI068171EST209862Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159093386269AI068302EST209993Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 12:30:35 on Fri 17 Nov 117.