CShisMan2_704


Sequence

>CShisMan2_704 (2 EST) Length=430 CCGAGAGCGTCTAAATTGTTAGTCTNGTTCAGTATCCTCATCATCGNATTACCACTTTCATCACTATTTCTGTCGAAATT CGTATTGTCAGATTTCTTTCACATGGNAATCTTCGTCTGCTTACATTGGGGCTGCAGTGGTCTCCATCATCGTCGTCCAT TTTGTGCTGTTAGGTTTTATCGTTGTCGCATTTTCAGAGACAAAACCCCACACTCCTGTTGTAGGACGGAAACATGAGTA ACGACATATCAAAAATTTGCCATCGACGCATTTGGGTTTCTCCTACTGTAGTAGGCAGTATATAAACATTCCTTTTCCCG TTTACTTCATTTGGTACTGTGACTTGTGGCTTTTATGGATTGTAAATAATTGCTTCCTGTAATTTATTTTACCTCTCAGT GCAGTTTTTTTATAAATAGAAAATCACTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_704: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180081125897N20725SMNHADA007016SKSmAW
4191621128013N21880SMNHADA019031SKSmAW


Date: 12:34:0 on Fri 17 Nov 117.