CShisMan2_705


Sequence

>CShisMan2_705 (5 EST) Length=597 CTGAGCTTTTAAACATACGAATTAATTTTATTTGTNAGTTTTTGANTTGATCAACAATCCATATATAACAGTATTTTTCC ACTAAAAGGTCTGTAAACAACAGTTTATTTGCNATCTTCTTTTCCATTCCTTGGATACAGTTAACTTCTAAACATATGCA CCAAGATACTTTTAAGCAAAAAAAAGTTACAAAATACATTAAACAACTCAAAATAATGTATCAAGACAAGCTGATATTCT GAACAGTAAGANAAATGAAATAAATTCACTGAAAATAATCACATTACATGTGACTGCTACTTATGCAACAGTATTTGAGT AGTAGTTCAAAACAAGCAAGTCAGATCAAACAATCAATGTAATAAAGTAACTGATAATTTGATGCATCAAAATATAAAAA TATAATCACATTGGTAGATACTTAATGATCCATGGAAATAGGTGGAAAGGGCTTTNTAATTTCACCTTTAAGTTGAATTG AGACAATGGAGGTGTTAATGAATTCAAAAAGAATTCGGTCAAATACAATTTNCGTAGCATTANCAATGAAATATGTCTAT AACTCAAGATAGCATAGTTGTATGTTTTCTCGTGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_705: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4350241154048N33649SMNHADA008054SKSmAW
7641941685510AA125691MLLG0263.M1FSchistosoma mansoni, lung stage
12098082330097AA559401MC250408.NA3TBRI-Saber-cercaria-A
15130122854292AA791337SMTBADA000783SKSchistosoma Lambda Zap II
16629063080331AA931022SMTBADA000088SKSchistosoma Lambda Zap II


Date: 12:45:56 on Tue 21 Nov 117.