CShisMan2_713


Sequence

>CShisMan2_713 (4 EST) Length=610 GTCAAGTCGGTAAATGACTCTAACATGATGGCATTAAAAGAATTAGTCGCAGCTCAACGAACTTATTTCACTGAATGCAA ACAGAGGACTGAAGAATTGTCTGCTCAAATGGAAAGATTAAAGTAAACATNTGCCTTTCGGGGGAGAAAAAAAAGAGGCT AAATTGAAATAAAAACAAAAAAAATCCAATTTTGTGTCTTTCCAGTAATAACTAATATATACATATATGGAACTTTATTT TGTGCAACAGTCACGCTATACAACTACTCTGTTGAAACTCTTTTTTGGTCCCAAATTCTTCGCGTTCCCCATCGATTTAA ACTGCTCGTCTTTTTTTTGTTATCTCCACACACCTTTACTGTTCAGTGTATATTTATATTAATATCGATATTATTTGCCT TATACATTTCAATAATGTCATTCATTACATTATTGAATTAAATAAGAAATTTACTTATTTCTTTTCAATGCTTTCATGAT TATTCTTCGATTTATGTTTGTGTACGTGTGTGTGTTTCTTTTCTGGTTTATGTGTATATTTCATATTTTTATTGTNTTTT TTGGTGGGTGGGTTGGTGTTGGTTGATTGAAAAATTATCTATTCTGTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_713: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191961128047N21914SMNHADA019096SKSmAW
17369253189845AA999290MCCE3100.M1FSchistosoma mansoni, cercariae
18694163509817AI111129MF003H05.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696343510035AI111065MF001D10.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 19:58:59 on Sat 18 Nov 117.