CShisMan2_717


Sequence

>CShisMan2_717 (2 EST) Length=413 CCCAGAGAAATAACGTTTTATTTGGAAAAATAAGAAACCTGAAATTAACCTCCAAATACACATCGACAATAAGCATCACG GTTAGAAGGAAAATACCAACAATAGCCGTAGCAACCANAAGGACGTACAAATCACTTGACTAAAAAAACAGTTTGACTTA TCATTAGCAGTTGAATAACAACACAATTAGTGGTTAGTTTTTTTGAAATAAAAAAGTGACTATGGTTACATAGGGATTAA AACTTATACATATATCCTATATATATATAATGTTTATGTACATTTGTACAAATGTTATCACTCTTGATTTCGATTCAATA ATAAGTAGATACCCATAACGCCTAAGATAGAGTATTTAATACGGGGATTTTNCATTNCATAATTATGGTGACTTGACCAA CATAAGGTATGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_717: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4189871126874N21704SMNHADA009071SKSmAW
4190561126943N21773SMNHADA018023SKSmAW


Date: 16:12:4 on Tue 21 Nov 117.