CShisMan2_724


Sequence

>CShisMan2_724 (2 EST) Length=700 CCAGTTGATAAAATTTTNTNAGAATATGATGCCGTGAGAAATAGAGTTTAGTATGTTTNCGAAAATACTTGANTTATTCA AGACCCGAGTTAGATGTNGTCAGAATCTTGCGGTTATCCTGTGAGTGACATAATAGCATTAACAACATCATCGTTATTTT CACGAAGCGCTCGAATAGCTTTGCCACGNGATACACCAGCTTGCTGCATAATGAGTTCAACATCCTTCTCATCCAATCCA GTAGCATCAGGCTCTTCATCATCTTCAGATTCCTCTGCGATGGCAGTTTTAGAGATAGACGAAACTGTATCTTTNGATAG GCCACTTGATGTCCCTAACTCAGTACCTCCCATGGCTTGACTACGGANGTTTTTTCAGCTGCAGCTATCTGGAGCTTGTG NTGATATATCTTCTACTTTAGCCTCACCAAATATTATGTATGTANCCGAGGCAGATGATTTATAGACCTCTGCCCTATTG ATTACAAACATAANGGNTTTTGCTTTTCGTATAGTTACGCGGNAAACTCCCTGTACCAATTTTAAGCCCAGTTTCGACAT AGCTTTCCTAGCTTTTTTCTCGCTTCTGGACTGCTTACATCGACTGAGTAANTCATCGGCTATATGTGATACTTTAGCAT CACCTTGTTCTTTAGAATCTTCTAANTCTGGTGCAGAGTCGTCCGAGTCACTGCCAGAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_724: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39301514695T14528SMEST0189Schistosoma mansoni, adult worm, Gloria Franco
39302514696T14529SMEST0190Schistosoma mansoni, adult worm, Gloria Franco


Date: 9:49:19 on Fri 24 Nov 117.