CShisMan2_728


Sequence

>CShisMan2_728 (5 EST) Length=629 TTGTTGTAGTAACAGTTTCCATTGTNTTGAATAACAATAATAATAAGAATAGCAATNAAACATTTTAACCCNACACATGN CNACAAGTTATAAGTAAACATCACTCCTTCACATACGTTACATTGTAGTACATTCACATGGATTATTGTTATTAGATTGA TAAGTAAGTTAAACTAAATGAAATTCTATCCTGATTTATATAGTAGTACAGCATACTTCTCCACGTAAAAATAGATGAAA CTATCTGGTTCATGAGTTATAGAACTGCCAAAATTCCTACCCACTANACAATGCCATGTTGGACCATATTTTTGATCAAA CTCTTTTTTTAAATGATCAGCTATATCTTTTTCTAATTCATATTTTCGAACTGAATCAATTCCAATAGAAAGAGCACGTT TTTGCATTTCATGCGTCATATCAGCATTTTTAATCACGGAATTATTAATTTTATACATGGACATTTCTTATTATGTAATT ATAAGGTCAGTTGAAATGTATCAGTGAATAATATTGGAATCTTTATGAAATCTCTTTATCTTGGATACGTGAATAACTTT TTTTTAATAATAATGATAAAGGGTAAACTATTGAAGAATAATTTAGTTGCTAACTGCTTTTAAAAATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CShisMan2_728: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344922975978R95608SMNHADA017059SKSmAW
4180501125939N20767SMNHADA008035SKSmAW
4192251128076N21943SMNHADA020055SKSmAW
11587242252901AA514097MA2MA109.AA3S. mansoni adult Lambda Zap
11587462252923AA514067MA2MA131.AA3S. mansoni adult Lambda Zap


Date: 13:16:8 on Thu 23 Nov 117.