CShisMan2_729


Sequence

>CShisMan2_729 (2 EST) Length=469 CAAATTCGGCAACTTGCATATCCTGGTGCAAGTTTAATTCTGCTTTGTTACGCAGTTGATTGTCCAACTAGTTTGGAAAA TATTGTGCACACATGGCTAGATGAAGTAAAATGCTACTGTCCACAAATACCACTCATACTGGTCGGATGTAAAGCTGATA AACGTGTGGTCATTGCACCAGGAAAGTCTAATAACTTAACTATGAATGCATCGCAGAACAGCTTTTGATCGATCCAAATG ATGTAGAAAAGGTTAGTAAACAAATTGGTGCACAAATTGTTATCGAATGTTCTGCTTTGACAAGATCCAATGTAAATAGT GTGTTTGAATTAGCTGCACGGATTATACTAGATGTAGAAAGAGAAAATATGCGAGCATCGAAATTCTATAACATACTTCC AACTCCATAGAAAGAATCATTTTCAATGGTGCAGTAACTGGGACCTCACTTATTACACGTGAAGCGCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_729: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5859001377961U58082SMU58082Schistosoma mansoni adult worm Lambda ZAP II library
18149063385266AI067299EST208977Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 9:19:45 on Sun 19 Nov 117.