CShisMan2_734


Sequence

>CShisMan2_734 (2 EST) Length=397 TGCCCCGAGAATACTTTCGAATAAACTTAACTGATCAAACTTTATGTTTTACTATTATTAACCCTTTGATTGGACCAATT GTAGTAATAGCGGTTATTACTCCGAATATTACTTATATTTATCTTAATTTCTCTATGGGTTTTTTTATACTGTAAAGCTT ATATGCTTATCAAAAATGCTATATACATATATATACGACTTATATGCGACTTATAATTAATTGGCTTATTTAAAGAATTG ATTTTGATGCAATAGTAGTAGTAGTGGTAGTAGTAATAGAAGTAATAGTTTTGTTGCTCTTTAATTATCCTTGTCAATTA TTTCCTGTTTGAAAAAACGATGTATGTTTACTTATTAATAAAACAAAAGTAATAAAATGAAATAAGCTATATATATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_734: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12099822330271AA559575MC070585.NA3TBRI-Saber-cercaria-A
17369223189842AA999287MCCE3096.M1FSchistosoma mansoni, cercariae


Date: 17:20:59 on Fri 24 Nov 117.