CShisMan2_747


Sequence

>CShisMan2_747 (8 EST) Length=527 GAGAGCAATACACAATATATAATTACTTTAAAAATATAAGTGACTTATTTTACACTCTAAATGTATACTGCCAAGAAAAT CGAAACATCCAAAGTTAATGGGCGAAGTTCATTAAAATTTTATAGAAAAAGATAAAGTAACAAAGTAATATAGTTCTGTT TTGATTCGAAATCGAAATAAAATATTCTGACGTAGTATTCTTTCATGCATTTGTACGATAAATGATGAAGGAATGCTGAT TGATTTTAAAATGAAACGAACAGTTTGGAATATGTGTATAAGTTGTCCAATATGAACCTCTGACAATAGTTACATGCCAA TGACGACCATATGTCGTGTCAAGCCATCTTTTAAGTTTTTCTGAAGCTTCCTTCTCTATAAATTTATCTTTGTGGTTGAG TAAGCCTATAAGCTTCTTCTGATATTTTTATTTGATCTTGTAATGGTAGTTTCTTGCATGATTAGCAAAGGTTTCAGGTC GGAGGCCGGGGGGAGGGATTCGGGACGATGGGCGATTGGGGATAGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_747: (8 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824231713261AA143856MCCE0235.M1FSchistosoma mansoni, cercariae
7824321713270AA143865MCCE0248.M1RSchistosoma mansoni, cercariae
7824601713298AA143893MCCE0281.M1RSchistosoma mansoni, cercariae
11587692252946AA514090MC2NE022.ACSS. mansoni cercarial Lambda Zap
12100242330313AA559617MC080562.NA3TBRI-Saber-cercaria-A
16099772992126AA883015SMTBCEA000043SKSchistosoma Lambda Zap II cercariae
16891453116514AA952808SMTBCEA000179SKSchistosoma Lambda Zap II cercariae
17369833189903AA999348MCCE3175.M1FSchistosoma mansoni, cercariae


Date: 23:30:16 on Fri 17 Nov 117.