CShisMan2_749


Sequence

>CShisMan2_749 (2 EST) Length=318 GATTCGGAACGAGATGGTAGCCGATGNGGACAAGTACAAGGTTGAGGATGAGAAGTAGAGAGATCGTNTTTCTGNAAAGA ACTCGNTTGAGAGTTATGTGTACACAATGAAAACAGCAAGTGGNGGGTGAGCTTANAGAAANGATACCTGAAAGTGATCG TCAAGTAATAATAAGCAAGTGTGAGGATACAATTAGTTGGCTGGACGTCCATCAGTCGGGGGAGTAAGCATGACTATGAA AGTAAGCGGCAGGAGTTGGAGAAGGTCTNTNCCCCCNATATTTACGAAGGTGTTCCCAGGCTTGGTGGGTNTNCCAGN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_749: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344951976007R95522SMNHADA018041SKSmAW
4427461165323H98299SMNHADA016038T3SmAW


Date: 11:4:52 on Tue 21 Nov 117.