CShisMan2_750


Sequence

>CShisMan2_750 (5 EST) Length=389 GAATTCGGAACGAGNAAACTTTNCATATTAGCTATTACTTCTAATTCATAAATGGCTGAATTAGTAGGAACATGGAAATT CTTGAAAGTTCCAACGTGGAAGAATTGTCTAGTGAATTAGGAACTCCTAATGATGTATTTAATGTTATCAATAAAAATGA AATCAAATATGATCATAGACCCGGATGATAATGAACGTACGCATAAAAATGATAATAGGTGATGAAGAACTGGATCAATC CTTNGAATTGGGTCAAGAAGTGGANGAATTAACATTGGATGGACGAATAGNTCGNGCTATTGTAACCATTGAATCAGACA AGAAAATGGTACATGTACAAAGGACATGGCTTTACAGAAACTGTCAATACACGTGAAGTNGNTGGGGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_750: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4179701125859N20687SMNHADA001013SKSmAW
4411261162896H98294SMNHADA016032T3SmAW
7364731644609AA098639SMTBADAMS0705SKS. mansoni cDNA
7364741644610AA098640SMTBADAMS0706SKS. mansoni cDNA
16891073116476AA952770SMTBADA000705SKSchistosoma Lambda Zap II


Date: 0:40:31 on Sat 25 Nov 117.