CShisMan2_751


Sequence

>CShisMan2_751 (2 EST) Length=397 TAAAAAAACATTTAGTTTAACTATCATATAGNGTTCATGAATCAAAATATTGATATTAATATGGAATATTAAAATGATTT CTCAATTATTATTATTGAGTTAACTGATTAGTTATTTGAATAAAATGCCTTCTGCTTATTCTTTCAATTTAAATAGTTCA TTCAATTCAACTGATCATATTCATTTATTCTTGAATGTGTTTAAATCTATCAAACTGAAGGTATTTATTTACTTGTGCTA ATAATAATCTTTTACATAATGGATTGTATTCCATTACAATCGGAATGATTAAAATCAGTATTCAATTAAAACGAATTGTG TATAACATTAAAAGAAAGTATATACTTCCATTTGAATTAATATGATATACACATGGAACATGGTCCAATGTTTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_751: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190331126920N21750SMNHADA017043SKSmAW
17368633189783AA999228MCCE3009.M1FSchistosoma mansoni, cercariae


Date: 10:0:45 on Fri 24 Nov 117.