CShisMan2_753


Sequence

>CShisMan2_753 (7 EST) Length=756 GCGACAACGCCTAAGAACATTTTCACAAACACAACTGACAGACCAGTAAGAATCAAATATGGAGGTCNGGATACATGACG CTGAAAAAATGTAACACGTACGTCATCAATGAATACAAGAAAGAAGGAAAAATATACGTTTATCGAAATGTTTTGTGTAG TGCCGCATTAAGGATCCATAGCATATTTCTGTGTCCACACTCTAGCTAATTCATCATATTTTTTACGATCTGTNTTTGTC TCGTGCCGAATTCGGCACGAGATATTACTTACTCTTCTTGATAATTATTGTTCCGCATATGGATATGGTTACCCATATTA TCATCGAAGACATTTGGATCCGGCTATTGCTTCAGTTACGAAGGAACCATATATAGGTGCGGTGTGGTTCACACAACATG GAGATTATNTGTACGTTAATGGAAGCGTGGNAGGACTCCCACCTGGAAAACTGTTGGGTACACATGTTCATCGNTATGGA GGACTTGGAAACATGTGTCTTGAAGCTGGTCCTCATTTCAATCCATTCAACCAACGTCATGGTCCACGTCATGGATACCC CAGACACGCTGGAGGATTTAGGAAACATTAGAGTTGGNCGAGGTGGTGTAGCGAAAATTTGGATTTCNTATGTTACTATA AAAGGACTAGGACCATCTGGATGGGATTTATTGGCCGAGCACTTGGTATACATGCAAATAGGGATGATCTTGGAAGAAAT CGAGACGAAGGCAGTAGAACAACGGGTAATTCTGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_753: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344962976018R95533SMNHADA018092SKSmAW
4071411119147H98262SMNHADA015006T3SmAW
4156381122581H98360SMNHADA015007T3SmAW
4191741128025N21892SMNHADA019050SKSmAW
14785712804067AA756897MF4MA139.AF3S. mansoni female adult Lambda Zap
16891783116547AA952841SMTBCEA000507SKSchistosoma Lambda Zap II cercariae
18151923385552AI067585EST209267Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 22:4:55 on Fri 17 Nov 117.