CShisMan2_754


Sequence

>CShisMan2_754 (2 EST) Length=388 TTAACTGATCTCTTGATATAAAACAGTACACGTACATAGTCTACACGCAGTTATAATCAATCGCACATATATATGCTACA TCAGATACTACTTACAACCTAATATGGTGCACATATACGCTTATGAATATGGCAAATACATGTCAACAGTAATAATAATA ACCAACCGTAACAGTTTTTAAACAAAATTCACATGTTTTACAAGTTTCTGTTTTGTTTTGCTTCTTTTAATCGTTAAATG TTTCTCTCTTCTTTTTTTTTTATTTCACTCTAATCATGATAAGTTTCTAGCAAATGTAAACCGTATATATTCCTTTTATT GCCACTATTCAATATTACTATTATCTTATTGTTATTATAACTATATGCGAATAAACATTTTTCTGTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_754: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5137831445036W06816SMEST0452Schistosoma mansoni, adult worm, Gloria Franco
7641561685472AA125720MLLG0153.M1FSchistosoma mansoni, lung stage


Date: 16:26:7 on Sat 18 Nov 117.