CShisMan2_756


Sequence

>CShisMan2_756 (2 EST) Length=389 CGTAAATAGAAAAGAATATTGAAAGCAATGTAGAAAATTGCTTAACGAAATTTTCAAACCAAACCTGATTAACAAAATTA AATTTGTGTTCTTTATTCATTCAAATACAGAGATTTTGTTTGTTTTTTTTCTATACATGTACATTGAAACATATATTTGG ATATATATATATGGATACCATAGATACTAACACTTTCAAAATGGGTAATAATCATTAGTTGTTTAGTTAGTTAGTTAGTT ACTGAATTAAGTAGTTAGTTCATTGACGAAAAATTATAAAAAAAAAGTTTGGTTTGTTTTGTTTCAATGAATAATTTTCC AGAAGATATTGATTGTTTTAAGTTTTTTTTTGTTGAAAAAAAGTTTTATTCAAATAATAAAGCGTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_756: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12099612330250AA559554MC070555.NA3TBRI-Saber-cercaria-A
17370433189963AA999408MCCE3260.M1FSchistosoma mansoni, cercariae


Date: 17:11:5 on Wed 22 Nov 117.