CShisMan2_758


Sequence

>CShisMan2_758 (4 EST) Length=691 AATCCGGAACGAGTTATAANCTCATAGNTCAATATTATAGATTTTTAGTGTTGTTTTTATTAACAATTTTTACGTTTCCA AAATTTGNCCCGTTACATTATTTTCATATAGCGNAGCCTGTGGTTAAGAAATGATGGGTATNGTNTTATTGGGTGGTGGA TTATTAATATTAAGCTNGTTATTGTGTCAGNTTCGTTTATTTAANTATATAATTATAGCTGAGAGATCTAACGTTATCGT GTCATTAGTAAGTCTATTAGATAGGATTANTGGTTGTCGNATGATATCGGTTACGATAATGAGGCTCCCGGGGATAGAAA ATATCATCAATGTTAATAATTGTAGCTGTAGAGATAAAGGAGGGGTGTTTTGCGGGCTTTCTACTGGTTTATAAAGGGTT TAATTTACAGGTTACTGTTAGGGTTGATTGTGTGGTGTCANCAGTATTGTATAGGACTATCCTATTCAAGGGACAAAAAT TTGTTTAATAAATGGTTTCTTTATACGTGATTGTCTGAGGTTTTTAATGGTATTGTTAGTTGTTACTATAGCTTGAGCTT TTGTAGTGATGGGTTTATCAAGTATAGTGTTATACTTCAGAATGATTAGAGCTATAATAGTATCAGTTGTAAATAAAGCT CTGTTGGCTTTGGACTTTTTTCCATGAACTTNCAATTATTAGTGCTTTGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_758: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4156821122625H98404SMNHADA016046T3SmAW
4180631125952N20780SMNHADA008059SKSmAW
4191671128018N21885SMNHADA019040SKSmAW
12099932330282AA559586MC080514.NA3TBRI-Saber-cercaria-A


Date: 10:27:23 on Sat 18 Nov 117.