CShisMan2_767


Sequence

>CShisMan2_767 (3 EST) Length=384 AATCCGGAACGAGGTTATTCAATAAAAAAGATTTACTTTACTGAATTTTTTNGTTTGAATTCTGCTTTATTACATTTGTT TTTTTCATTTGAACAAAATCAAATATGGATAGTCCAATGGAAAAATTTATTCAAACTTATTTAACTTTACTTCGTGATGG TGATGAAACTGTTGAAACAAGTAAATTAAGTGAAAGTTGTAGAAAAGAAAAACTTGATATGAAACAAGTTAATGAGTGGA TTGCTCTTTNCGATGTAGACAAAGATCAAAAAATCACTTTTGAAGAATTTTGTCGTGGGTTTGGGATTGAAACAGAATGA AATGCNGTTTTGANCGAAATCACATTAAANCTGTACAGGCAGGTAGAGAACAAANGCTNACCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_767: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4071771119183H98298SMNHADA016037T3SmAW
8578411832601AA218508MAAD0183.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
12102042330493AA559797MC250461.NA3TBRI-Saber-cercaria-A


Date: 13:16:53 on Wed 22 Nov 117.