CShisMan2_769


Sequence

>CShisMan2_769 (3 EST) Length=497 AATNCGGNNCGAGTAAAGAGTAACGATAAAGNAACGTCATGAGGAATATGGTAAAGATCAATATTATGAAAAATCAAAAC CTGACAATGGAAAGAATTATCTTGATAAAAAANCAGATTATGATGAGGTAAAAAATAAAAAAATCCCAGAAAAGAAAAAA GCTAAATCAGAAGAGAAAAGTGAAGAGAATAAAAAACAAGTTGAAAAGGATGTAAAATATCCAAGGGAAGATAATGTAAT TAAAGTGATTAATGAATACTCATAAACATAATTAAAGTAATGAATATAATAATAATTTAATCATAAATATAGTAATTTAA TGTAATAGTAATAATAACATGATTATCTAATTATGATTCTTTTATGAACTGTTGATCATCCATNCTGGAGATCAAAAAGA AATTGANTGAATAAAACATTGGCAAAAAAGATTGATCAANTTTGTAATAAAACCTATTTCTCTTTCTTAAAAAAAACGTC TGTTCAAACTCATTGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_769: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344956976012R95527SMNHADA018065SKSmAW
4190151126902N21732SMNHADA016017T3SmAW
12165862338835AA566203MA3MR075.AA3S. mansoni adult Lambda Zap


Date: 23:23:48 on Mon 20 Nov 117.